Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6850

expand all nodes | collapse all nodes | view schema

Name Class

Expr6850Expression_ofGeneWBGene00012321
Reflects_endogenous_expression_ofWBGene00012321
HomolHomol_homolW07A8:Expr
Expression_data (2)
TypeReporter_gene[srxa-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCAATTTTTGGATTTTTCG] 3' and primer B 5' [TGAGAAAATCGACCTGGAGAA] 3'.
PatternAdult Expression: Nervous System; head neurons; tail neurons;
Larval Expression: intestine; Nervous System; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : ASH + ASI amphid neurons; PHB phasmid neuron. Very strong and consistent expression in PHB. Weaker and more inconsistently in ASH and very weak in ASI. (Sengupta Lab 2005)
Strain: BC14847
ReferenceWBPaper00006525
TransgeneWBTransgene00003743