Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6815

expand all nodes | collapse all nodes | view schema

Name Class

Expr6815Expression_ofGeneWBGene00001394
Reflects_endogenous_expression_ofWBGene00001394
HomolHomol_homolCHROMOSOME_IV:Expr
Expression_data (2)
TypeReporter_gene[fat-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAATCACTCGTTGGAAGT] 3' and primer B 5' [CGGGGGCCAAGTTTTACT] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons;
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC14187
ReferenceWBPaper00006525
TransgeneWBTransgene00003437