WormBase Tree Display for Expr_pattern: Expr6777
expand all nodes | collapse all nodes | view schema
Expr6777 | Expression_of | Gene | WBGene00001005 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001005 | ||
Homol | Homol_homol | T26A5:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (7) | |||
Type | Reporter_gene | [dlc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACTTTGTGATCGTCGGATTTA] 3' and primer B 5' [ATTTTGAACGGATTTGGCTG] 3'. | |
Pattern | Adult Expression: pharynx; Nervous System; head neurons; neurons along body; unidentified cells in tail ; | ||
Larval Expression: pharynx; body wall muscle; Nervous System; head neurons; tail neurons; | |||
Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated. | ||
Strain: BC12911 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004316 |