Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6601

expand all nodes | collapse all nodes | view schema

Name Class

Expr6601Expression_ofGeneWBGene00003375
Reflects_endogenous_expression_ofWBGene00003375
HomolHomol_homolT04C9:Expr
Expression_data (2)
TypeReporter_gene[mlp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTCCTCCTCCAACAAAATCTTA] 3' and primer B 5' [GGCTTGAATGGGATTCTGG] 3'.
PatternAdult Expression: intestine; rectal gland cells; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; tail neurons;
Larval Expression: intestine; rectal gland cells; body wall muscle; Nervous System; head neurons; tail neurons;
RemarkStrain: BC11742
ReferenceWBPaper00006525
TransgeneWBTransgene00002681