WormBase Tree Display for Expr_pattern: Expr6562
expand all nodes | collapse all nodes | view schema
Expr6562 | Expression_of | Gene | WBGene00020146 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00020146 | ||
Homol | Homol_homol | T01C8:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [T01C8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGCAATGTTAGACCTTGAAA] 3' and primer B 5' [CGTCAAAGAAGGAGATGTTGAGT] 3'. | |
Pattern | Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; vulval muscle; vulva other; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; | |||
Picture | WBPicture0000006151 | ||
WBPicture0000006152 | |||
WBPicture0000006153 | |||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, some are neural, others possibly epithelial | ||
Strain: BC12789 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004379 |