WormBase Tree Display for Expr_pattern: Expr6562
expand all nodes | collapse all nodes | view schema
Expr6562 | Expression_of | Gene | WBGene00020146 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00020146 | ||||
Homol | Homol_homol | T01C8:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005300 | |||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005753 | |||||
WBbt:0005772 | |||||
WBbt:0005799 | |||||
WBbt:0005812 | |||||
WBbt:0005813 | |||||
WBbt:0005821 | |||||
WBbt:0006748 | |||||
WBbt:0006760 | |||||
Type | Reporter_gene | [T01C8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGCAATGTTAGACCTTGAAA] 3' and primer B 5' [CGTCAAAGAAGGAGATGTTGAGT] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; vulval muscle; vulva other; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; | |||||
Picture | WBPicture0000006151 | ||||
WBPicture0000006152 | |||||
WBPicture0000006153 | |||||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, some are neural, others possibly epithelial | ||||
Strain: BC12789 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004379 |