WormBase Tree Display for Expr_pattern: Expr6561
expand all nodes | collapse all nodes | view schema
Expr6561 | Expression_of | Gene | WBGene00020142 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00020142 | ||
Homol | Homol_homol | T01C8:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003681 | ||
WBbt:0005735 | |||
WBbt:0005812 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [aak-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCGACATTCGAGAGGATTTAC] 3' and primer B 5' [GAAAAGATTTCTGAAAATAGTCGG] 3'. | |
Pattern (2) | |||
Picture | WBPicture0000006148 | ||
WBPicture0000006149 | |||
WBPicture0000006150 | |||
Remark | Also expressed in (comments from author) : Neural in the tail is possibly the phasmid sheath cells. | ||
Strain: BC10615 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002337 |