WormBase Tree Display for Expr_pattern: Expr6503
expand all nodes | collapse all nodes | view schema
Expr6503 | Expression_of | Gene | WBGene00011240 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00011240 | ||
Homol | Homol_homol | R11A8:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [R11A8.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGTTTTTCTCATATTTGTTTCT] 3' and primer B 5' [TTTCTAATGGAATGAGGTGATTGA] 3'. | |
Pattern | Larval Expression: pharynx; intestine; rectal epithelium; developing vulva; hypodermis; seam cells; Nervous System; head neurons; amphid socket cells; neurons along body; unidentified cells in head; | ||
Remark | Also expressed in (comments from author) : Embryo and adult incomplete. To be updated. | ||
Strain: BC14319 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004573 |