Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6503

expand all nodes | collapse all nodes | view schema

Name Class

Expr6503Expression_ofGeneWBGene00011240
Reflects_endogenous_expression_ofWBGene00011240
HomolHomol_homolR11A8:Expr
Expression_data (2)
TypeReporter_gene[R11A8.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGTTTTTCTCATATTTGTTTCT] 3' and primer B 5' [TTTCTAATGGAATGAGGTGATTGA] 3'.
PatternLarval Expression: pharynx; intestine; rectal epithelium; developing vulva; hypodermis; seam cells; Nervous System; head neurons; amphid socket cells; neurons along body; unidentified cells in head;
RemarkAlso expressed in (comments from author) : Embryo and adult incomplete. To be updated.
Strain: BC14319
ReferenceWBPaper00006525
TransgeneWBTransgene00004573