WormBase Tree Display for Expr_pattern: Expr6467

Expr6467 Expression_of: Gene: WBGene00005071
    Reflects_endogenous_expression_of: WBGene00005071
  Homol: Homol_homol: R05H5:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003681
      WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0006753
      WBbt:0006759
  Type: Reporter_gene: [srb-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCCAAAACTGCTGAACTT] 3' and primer B 5' [CGTCGCAGTCATTCATTTTTATT] 3'.
  Pattern: Adult Expression: pharynx; Nervous System; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ;
    Larval Expression: unidentified cells in head; unidentified cells in tail ;
  Remark: Also expressed in (comments from author) : PHA phasmid neuron (Thomas Lab, 2005). Embryo incomplete. To be updated.
    Strain: BC12256
  Reference: WBPaper00006525
  Transgene: WBTransgene00002881