WormBase Tree Display for Expr_pattern: Expr6467
expand all nodes | collapse all nodes | view schema
Expr6467 | Expression_of | Gene | WBGene00005071 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00005071 | ||
Homol | Homol_homol | R05H5:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [srb-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCCAAAACTGCTGAACTT] 3' and primer B 5' [CGTCGCAGTCATTCATTTTTATT] 3'. | |
Pattern | Adult Expression: pharynx; Nervous System; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : PHA phasmid neuron (Thomas Lab, 2005). Embryo incomplete. To be updated. | ||
Strain: BC12256 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002881 |