Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6467

expand all nodes | collapse all nodes | view schema

Name Class

Expr6467Expression_ofGeneWBGene00005071
Reflects_endogenous_expression_ofWBGene00005071
HomolHomol_homolR05H5:Expr
Expression_data (2)
TypeReporter_gene[srb-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCCAAAACTGCTGAACTT] 3' and primer B 5' [CGTCGCAGTCATTCATTTTTATT] 3'.
PatternAdult Expression: pharynx; Nervous System; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ;
Larval Expression: unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : PHA phasmid neuron (Thomas Lab, 2005). Embryo incomplete. To be updated.
Strain: BC12256
ReferenceWBPaper00006525
TransgeneWBTransgene00002881