WormBase Tree Display for Expr_pattern: Expr6376
expand all nodes | collapse all nodes | view schema
| Expr6376 | Homol | Homol_homol | K09E10:Expr |
|---|---|---|---|
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005439 | ||
| WBbt:0005735 | |||
| WBbt:0005772 | |||
| WBbt:0005799 | |||
| WBbt:0006751 | |||
| Type | Reporter_gene | [K09E10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGAATAGAGACCTGTGAGTGG] 3' and primer B 5' [ATGATTGTGATCGTGGCAAA] 3'. | |
| Pattern | Adult Expression: intestine; rectal gland cells; | ||
| Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; pharyngeal neurons; | |||
| Picture | WBPicture0000005836 | ||
| WBPicture0000005837 | |||
| Remark | Strain: BC11909 | ||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002747 | ||
| Historical_gene | WBGene00019581 | Note: This object originally referred to a gene (WBGene00019581) that has been suppressed. Please interpret with discretion. |
