WormBase Tree Display for Expr_pattern: Expr6376
expand all nodes | collapse all nodes | view schema
Expr6376 | Homol | Homol_homol | K09E10:Expr |
---|---|---|---|
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005439 | ||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0005799 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [K09E10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGAATAGAGACCTGTGAGTGG] 3' and primer B 5' [ATGATTGTGATCGTGGCAAA] 3'. | |
Pattern | Adult Expression: intestine; rectal gland cells; | ||
Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; pharyngeal neurons; | |||
Picture (2) | |||
Remark | Strain: BC11909 | ||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002747 | ||
Historical_gene | WBGene00019581 | Note: This object originally referred to a gene (WBGene00019581) that has been suppressed. Please interpret with discretion. |