WormBase Tree Display for Expr_pattern: Expr6366
expand all nodes | collapse all nodes | view schema
Expr6366 | Expression_of | Gene | WBGene00002002 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00002002 | ||
Homol | Homol_homol | K08E7:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
Anatomy_term | WBbt:0003681 | ||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005772 | |||
WBbt:0005813 | |||
WBbt:0005821 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [hsb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTTTTGTCGAATGAAACGAAT] 3' and primer B 5' [ACTTCTCATCGGAGATTTTGAAC] 3'. | |
Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; Nervous System; tail neurons; | ||
Remark | Also expressed in (comments from author) : incomplete. Will be updated. | ||
Strain: BC11914 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002749 |