WormBase Tree Display for Expr_pattern: Expr6321
expand all nodes | collapse all nodes | view schema
| Expr6321 | Expression_of | Gene | WBGene00001089 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00001089 | ||
| Homol | Homol_homol | K04A8:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003679 | ||
| WBbt:0003681 | |||
| WBbt:0004292 | |||
| WBbt:0005735 | |||
| WBbt:0005813 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [K04A8.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAGCGGTGTCGTCTGCTCT] 3' and primer B 5' [CAGAGACGATGTCGGTCCTT] 3'. | |
| Pattern | Adult Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; neurons along body; tail neurons; | ||
| Larval Expression: pharynx; body wall muscle; Nervous System; tail neurons; unidentified cells; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC10432 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002252 |
