WormBase Tree Display for Expr_pattern: Expr6310
expand all nodes | collapse all nodes | view schema
Expr6310 | Expression_of | Gene | WBGene00000450 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000450 | ||
Homol | Homol_homol | K03A11:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0005735 | ||
WBbt:0006751 | |||
Type | Reporter_gene | [ceh-28::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGGGTAGCAACAGATGTGAA] 3' and primer B 5' [TGCGTAGATTGGATTGGGA] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; | ||
Larval Expression: Nervous System; head neurons; | |||
Picture | WBPicture0000009152 | ||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC12998 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002431 |