WormBase Tree Display for Expr_pattern: Expr6293
expand all nodes | collapse all nodes | view schema
| Expr6293 | Homol | Homol_homol | H38K22:Expr | ||
|---|---|---|---|---|---|
| Expression_data | Life_stage | WBls:0000041 | |||
| WBls:0000023 | |||||
| Anatomy_term | WBbt:0003681 | ||||
| WBbt:0005733 | |||||
| WBbt:0005741 | Partial | ||||
| Remark | unidentified cells | ||||
| WBbt:0005800 | |||||
| WBbt:0005813 | |||||
| Type | Reporter_gene | [H38K22.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAACTTTTCCCTATTTCCCCTAT] 3' and primer B 5' [AGTAGGGGACTCGATTTTCACA] 3'. | |||
| Pattern | Adult Expression: pharynx; rectal epithelium; body wall muscle; hypodermis; unidentified cells in tail ; | ||||
| Larval Expression: pharynx; rectal epithelium; body wall muscle; hypodermis; unidentified cells in tail ; | |||||
| Picture | WBPicture0000005712 | ||||
| WBPicture0000005713 | |||||
| WBPicture0000005714 | |||||
| WBPicture0000005715 | |||||
| Remark | Also expressed in (comments from author) : unidentifeid cells around anal poreMosaic population. | ||||
| Strain: BC12609 | |||||
| Reference | WBPaper00006525 | ||||
| Transgene | WBTransgene00004474 | ||||
| Historical_gene | WBGene00010429 | Note: This object originally referred to a gene (WBGene00010429) that is now considered dead. Please interpret with discretion. |
