WormBase Tree Display for Expr_pattern: Expr6293
expand all nodes | collapse all nodes | view schema
| Expr6293 | Homol | Homol_homol | H38K22:Expr |
|---|---|---|---|
| Expression_data (2) | |||
| Type | Reporter_gene | [H38K22.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAACTTTTCCCTATTTCCCCTAT] 3' and primer B 5' [AGTAGGGGACTCGATTTTCACA] 3'. | |
| Pattern (2) | |||
| Picture (4) | |||
| Remark (2) | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004474 | ||
| Historical_gene | WBGene00010429 | Note: This object originally referred to a gene (WBGene00010429) that is now considered dead. Please interpret with discretion. |
