WormBase Tree Display for Expr_pattern: Expr6276
expand all nodes | collapse all nodes | view schema
Expr6276 | Expression_of | Gene | WBGene00006541 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006541 | ||
Homol | Homol_homol | H13N06:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005319 | ||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005772 | |||
WBbt:0005799 | |||
WBbt:0005828 | |||
WBbt:0006751 | |||
Type | Reporter_gene | [tbh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCACCCTCTCCTTCTTGATGTT] 3' and primer B 5' [CAACGGCACTTCTGATTTTTC] 3'. | |
Pattern | Adult Expression: intestine; rectal gland cells; Reproductive System; spermatheca; gonad sheath cells; Nervous System; head neurons; | ||
Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; | |||
Picture | WBPicture0000005676 | ||
WBPicture0000009240 | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC12162 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002846 |