Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6262

expand all nodes | collapse all nodes | view schema

Name Class

Expr6262Expression_ofGeneWBGene00004134
Reflects_endogenous_expression_ofWBGene00004134
HomolHomol_homolF59B10:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (17)
TypeReporter_gene[pqn-47::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTTTTCTTCAAAAACCCCCA] 3' and primer B 5' [CGACATGTTCGAAGTGTGCTA] 3'.
PatternAdult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; head mesodermal cell; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; head mesodermal cell; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Picture (6)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15924
ReferenceWBPaper00006525
TransgeneWBTransgene00004129