WormBase Tree Display for Expr_pattern: Expr6117

Expr6117 Expression_of: Gene: WBGene00000105
    Reflects_endogenous_expression_of: WBGene00000105
  Homol: Homol_homol: K02B9:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term (12)
  Type: Reporter_gene: [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'.
  Pattern: Adult Expression: pharynx; Reproductive System; uterus; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ;
    Larval Expression: pharynx; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ;
  Picture: WBPicture0000005375
    WBPicture0000005376
    WBPicture0000005377
    WBPicture0000005378
    WBPicture0000005379
  Remark: Also expressed in (comments from author) : unidentified cells in head and tail, some probably neural, also maybe head mesodermal cell.Mosaic population.
    Strain: BC12839
  Reference: WBPaper00006525
  Transgene: WBTransgene00002986