WormBase Tree Display for Expr_pattern: Expr6117
expand all nodes | collapse all nodes | view schema
Expr6117 | Expression_of | Gene | WBGene00000105 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000105 | ||||
Homol | Homol_homol | K02B9:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005319 | |||||
WBbt:0005733 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005753 | |||||
WBbt:0005813 | |||||
WBbt:0005828 | |||||
WBbt:0006748 | |||||
WBbt:0006756 | |||||
WBbt:0006760 | |||||
Type | Reporter_gene | [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'. | |||
Pattern | Adult Expression: pharynx; Reproductive System; uterus; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; | |||||
Picture | WBPicture0000005375 | ||||
WBPicture0000005376 | |||||
WBPicture0000005377 | |||||
WBPicture0000005378 | |||||
WBPicture0000005379 | |||||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, some probably neural, also maybe head mesodermal cell.Mosaic population. | ||||
Strain: BC12839 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002986 |