WormBase Tree Display for Expr_pattern: Expr6063
expand all nodes | collapse all nodes | view schema
Expr6063 | Expression_of | Gene | WBGene00009664 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00009664 | ||
Homol | Homol_homol | F43G9:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [F43G9.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCATATCGTTTTGGAAACCT] 3' and primer B 5' [CAAAAATATTTGAGATGGAAGGAA] 3'. | |
Pattern | Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : possibly a few neurons in head and tail | ||
Strain: BC10381 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002222 |