Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6063

expand all nodes | collapse all nodes | view schema

Name Class

Expr6063Expression_ofGeneWBGene00009664
Reflects_endogenous_expression_ofWBGene00009664
HomolHomol_homolF43G9:Expr
Expression_data (2)
TypeReporter_gene[F43G9.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCATATCGTTTTGGAAACCT] 3' and primer B 5' [CAAAAATATTTGAGATGGAAGGAA] 3'.
PatternAdult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : possibly a few neurons in head and tail
Strain: BC10381
ReferenceWBPaper00006525
TransgeneWBTransgene00002222