Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6058

expand all nodes | collapse all nodes | view schema

Name Class

Expr6058Expression_ofGeneWBGene00003619
Reflects_endogenous_expression_ofWBGene00003619
HomolHomol_homolF43C1:Expr
Expression_data (2)
TypeReporter_gene[nhr-20::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTTGGAGTTTCGTGCCAG] 3' and primer B 5' [TCGTTCTTGTTTGATTCAATGTTT] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine - . cells; Reproductive System; distal tip cell; uterine muscle; spermatheca; Nervous System; nerve ring; head neurons; amphids; tail neurons; phasmids;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; Nervous System; nerve ring; head neurons; amphids; tail neurons; phasmids; unidentified cells in head;
RemarkStrain: BC12690
ReferenceWBPaper00006525
TransgeneWBTransgene00002932