Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6052

expand all nodes | collapse all nodes | view schema

Name Class

Expr6052Expression_ofGeneWBGene00002162
Reflects_endogenous_expression_ofWBGene00002162
HomolHomol_homolF42G8:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (22)
TypeReporter_gene[isp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGGTTGATCTTTGTGGATAC] 3' and primer B 5' [AAGAGAAGCCATTGCCCC] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ;
Picture (8)
RemarkAlso expressed in (comments from author) : HIgh intensity GFP
Strain: BC14279
ReferenceWBPaper00006525
TransgeneWBTransgene00003482