WormBase Tree Display for Expr_pattern: Expr6047
expand all nodes | collapse all nodes | view schema
Expr6047 | Homol | Homol_homol | F42G2:Expr | ||
---|---|---|---|---|---|
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005821 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [F42G2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACCTTGACCGGAAATTGT] 3' and primer B 5' [ATCACGGATTTGTGATGGTT] 3'. | |||
Pattern (2) | |||||
Remark | Strain: BC10261 | ||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002161 | ||||
Historical_gene | WBGene00043320 | Note: This object originally referred to a gene (WBGene00043320) that is now considered dead. Please interpret with discretion. |