WormBase Tree Display for Expr_pattern: Expr6047
expand all nodes | collapse all nodes | view schema
Expr6047 | Homol | Homol_homol | F42G2:Expr |
---|---|---|---|
Expression_data (2) | |||
Type | Reporter_gene | [F42G2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACCTTGACCGGAAATTGT] 3' and primer B 5' [ATCACGGATTTGTGATGGTT] 3'. | |
Pattern (2) | |||
Remark | Strain: BC10261 | ||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002161 | ||
Historical_gene | WBGene00043320 | Note: This object originally referred to a gene (WBGene00043320) that is now considered dead. Please interpret with discretion. |