Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6014

expand all nodes | collapse all nodes | view schema

Name Class

Expr6014Expression_ofGeneWBGene00009580
Reflects_endogenous_expression_ofWBGene00009580
HomolHomol_homolF40F9:Expr
Expression_dataLife_stage (2)
Anatomy_term (13)
TypeReporter_gene[F40F9.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGCATTTGTCGTAATTCCA] 3' and primer B 5' [TCAACAAGTGAGATAGAAGCAAAA] 3'.
PatternAdult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: anal depressor muscle; hypodermis; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ;
RemarkStrain: BC10471
ReferenceWBPaper00006525
TransgeneWBTransgene00002272