WormBase Tree Display for Expr_pattern: Expr6012
expand all nodes | collapse all nodes | view schema
| Expr6012 | Expression_of | Gene | WBGene00009575 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00009575 | ||
| Homol | Homol_homol | F40F8:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003681 | ||
| WBbt:0005733 | |||
| WBbt:0005735 | |||
| WBbt:0005772 | |||
| Type | Reporter_gene | [F40F8.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCCTTTCTTGTGCTATGTTTGT] 3' and primer B 5' [ACCACGTTGTGGATGTCGT] 3'. | |
| Pattern | Adult Expression: intestine; Nervous System; | ||
| Larval Expression: pharynx; intestine; hypodermis; Nervous System; | |||
| Remark | Also expressed in (comments from author) : First observations detected neural expression in the head. Second observations months later, did not see neural expression. | ||
| Strain: BC11064 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002470 |
