Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6000

expand all nodes | collapse all nodes | view schema

Name Class

Expr6000Expression_ofGeneWBGene00000072
Reflects_endogenous_expression_ofWBGene00000072
HomolHomol_homolF39C12:Expr
Expression_data (2)
TypeReporter_gene[add-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATGCTCATCTTTTAAGCAGAA] 3' and primer B 5' [TTTTCTTCCAATGATCTGAAACTT] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC14070
ReferenceWBPaper00006525
TransgeneWBTransgene00003395