Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5988

expand all nodes | collapse all nodes | view schema

Name Class

Expr5988Expression_ofGeneWBGene00001029
Reflects_endogenous_expression_ofWBGene00001029
HomolHomol_homolF38A5:Expr
Expression_data (2)
TypeReporter_gene[dnj-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTATCACATTACAAGAAAAAGCG] 3' and primer B 5' [AAATTGCCCGTAGTGATCTATAA] 3'.
PatternAdult Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC11063
ReferenceWBPaper00006525
TransgeneWBTransgene00002469