Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5886

expand all nodes | collapse all nodes | view schema

Name Class

Expr5886Expression_ofGeneWBGene00000230
Reflects_endogenous_expression_ofWBGene00000230
HomolHomol_homolF27C1:Expr
Expression_data (2)
TypeReporter_gene[F27C1.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCGCGCCTTTAATGTATTTC] 3' and primer B 5' [AGTTGCGCGATTACCTGC] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; body wall muscle; hypodermis; Nervous System; head neurons;
Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; Nervous System; head neurons;
RemarkStrain: BC11026
ReferenceWBPaper00006525
TransgeneWBTransgene00002453