WormBase Tree Display for Expr_pattern: Expr5868
expand all nodes | collapse all nodes | view schema
Expr5868 | Expression_of | Gene | WBGene00017811 | Inferred_automatically |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00017811 | |||
Homol | Homol_homol | CHROMOSOME_III:Expr | ||
Expression_data | Life_stage | WBls:0000041 | ||
WBls:0000023 | ||||
Anatomy_term | WBbt:0004506 | |||
WBbt:0004520 | ||||
WBbt:0005439 | ||||
WBbt:0005735 | ||||
WBbt:0005747 | ||||
WBbt:0005772 | ||||
WBbt:0005813 | ||||
WBbt:0006748 | ||||
WBbt:0006751 | ||||
WBbt:0006759 | ||||
Type | Reporter_gene | [F26A1.14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCGAGCTTTTTGATCACTCG] 3' and primer B 5' [GTGGTGAGATTGTTGGCTGAT] 3'. | ||
Pattern | Adult Expression: intestine; body wall muscle; Nervous System; head neurons; pharyngeal neurons; tail neurons; | |||
Larval Expression: intestine; Reproductive System; distal tip cell; developing vulva; body wall muscle; Nervous System; head neurons; pharyngeal neurons; tail neurons; | ||||
Picture | WBPicture0000004921 | |||
WBPicture0000004922 | ||||
WBPicture0000004923 | ||||
Remark | Also expressed in (comments from author) : No comments. | |||
Strain: BC14986 | ||||
Reference | WBPaper00006525 | |||
Transgene | WBTransgene00003818 | |||
Historical_gene | WBGene00017812 | Note: This object originally referred to WBGene00017812. WBGene00017812 is now considered dead and has been merged into WBGene00017811. WBGene00017811 has replaced WBGene00017812 accordingly. |