WormBase Tree Display for Expr_pattern: Expr5868
expand all nodes | collapse all nodes | view schema
| Expr5868 | Expression_of (2) | ||
|---|---|---|---|
| Homol | Homol_homol | CHROMOSOME_III:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [F26A1.14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCGAGCTTTTTGATCACTCG] 3' and primer B 5' [GTGGTGAGATTGTTGGCTGAT] 3'. | |
| Pattern (2) | |||
| Picture (3) | |||
| Remark (2) | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003818 | ||
| Historical_gene | WBGene00017812 | Note: This object originally referred to WBGene00017812. WBGene00017812 is now considered dead and has been merged into WBGene00017811. WBGene00017811 has replaced WBGene00017812 accordingly. |
