WormBase Tree Display for Expr_pattern: Expr5865
expand all nodes | collapse all nodes | view schema
Expr5865 | Expression_of | Gene | WBGene00001650 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001650 | ||
Homol | Homol_homol | T13H10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0004697 | ||
WBbt:0005319 | |||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005798 | |||
WBbt:0005813 | |||
WBbt:0005821 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [gon-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCAGAATGAACAAAGGGGGT] 3' and primer B 5' [CGGATACCAACAGCTCCG] 3'. | |
Pattern | Adult Expression: anal sphincter; Reproductive System; vulval muscle; spermatheca; body wall muscle; head mesodermal cell; Nervous System; head neurons; tail neurons; | ||
Larval Expression: anal sphincter; body wall muscle; Nervous System; head neurons; tail neurons; | |||
Picture | WBPicture0000004910 | ||
WBPicture0000004911 | |||
WBPicture0000004912 | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC13313 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003137 |