WormBase Tree Display for Expr_pattern: Expr5865
expand all nodes | collapse all nodes | view schema
| Expr5865 | Expression_of | Gene | WBGene00001650 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00001650 | ||
| Homol | Homol_homol | T13H10:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [gon-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCAGAATGAACAAAGGGGGT] 3' and primer B 5' [CGGATACCAACAGCTCCG] 3'. | |
| Pattern | Adult Expression: anal sphincter; Reproductive System; vulval muscle; spermatheca; body wall muscle; head mesodermal cell; Nervous System; head neurons; tail neurons; | ||
| Larval Expression: anal sphincter; body wall muscle; Nervous System; head neurons; tail neurons; | |||
| Picture | WBPicture0000004910 | ||
| WBPicture0000004911 | |||
| WBPicture0000004912 | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC13313 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003137 |
