WormBase Tree Display for Expr_pattern: Expr5709
expand all nodes | collapse all nodes | view schema
| Expr5709 | Expression_of | Gene | WBGene00006160 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00006160 | ||
| Homol | Homol_homol | F10A3:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003681 | ||
| WBbt:0005735 | |||
| Type | Reporter_gene | [str-108::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACACTTTCCATGGTGGC] 3' and primer B 5' [AGAAGAGCAGATCCTGAAGGTG] 3'. | |
| Pattern | Adult Expression: Nervous System; | ||
| Larval Expression: pharynx; Nervous System; | |||
| Picture | WBPicture0000004662 | ||
| Remark | Also expressed in (comments from author) : Variable punctate expression in what appears to be amphid sheath cells in nose tip. Does not appear to be neuronal expression (Hobert Lab apr 2005) | ||
| Strain: BC13458 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003176 |
