WormBase Tree Display for Expr_pattern: Expr5709
expand all nodes | collapse all nodes | view schema
Expr5709 | Expression_of | Gene | WBGene00006160 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006160 | ||
Homol | Homol_homol | F10A3:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0003681 | ||
WBbt:0005735 | |||
Type | Reporter_gene | [str-108::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACACTTTCCATGGTGGC] 3' and primer B 5' [AGAAGAGCAGATCCTGAAGGTG] 3'. | |
Pattern | Adult Expression: Nervous System; | ||
Larval Expression: pharynx; Nervous System; | |||
Picture | WBPicture0000004662 | ||
Remark | Also expressed in (comments from author) : Variable punctate expression in what appears to be amphid sheath cells in nose tip. Does not appear to be neuronal expression (Hobert Lab apr 2005) | ||
Strain: BC13458 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003176 |