WormBase Tree Display for Expr_pattern: Expr5641

Expr5641 Expression_of: Gene: WBGene00005938
    Reflects_endogenous_expression_of: WBGene00005938
  Homol: Homol_homol: E02C12:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0005394
      WBbt:0005735
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0005772 Partial
        Remark: posterior cells
      WBbt:0006751
  Type: Reporter_gene: [srx-47::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCAATTAGCTTGACACGAAA] 3' and primer B 5' [TCAATCAACGCGTATATAACCTG] 3'.
  Pattern: Adult Expression: intestine - posterior cells; Nervous System; head neurons; amphids; unidentified cells in tail ;
    Larval Expression: intestine - posterior cells; Nervous System; head neurons; amphids; unidentified cells in tail ;
  Picture: WBPicture0000004451
  Remark: Also expressed in (comments from author) : ASH amphid neuron; Also expression in a non-DiI stained, non-ASE/AWC head neuron pair sending dendrite to tip of nose (Hobert Lab 2005).
    Strain: BC13449
  Reference: WBPaper00006525
  Transgene: WBTransgene00003173