WormBase Tree Display for Expr_pattern: Expr5641
expand all nodes | collapse all nodes | view schema
Expr5641 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | E02C12:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005394 | ||||
WBbt:0005735 | |||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | Partial | ||||
Remark | posterior cells | ||||
WBbt:0006751 | |||||
Type | Reporter_gene | [srx-47::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCAATTAGCTTGACACGAAA] 3' and primer B 5' [TCAATCAACGCGTATATAACCTG] 3'. | |||
Pattern | Adult Expression: intestine - posterior cells; Nervous System; head neurons; amphids; unidentified cells in tail ; | ||||
Larval Expression: intestine - posterior cells; Nervous System; head neurons; amphids; unidentified cells in tail ; | |||||
Picture | WBPicture0000004451 | ||||
Remark | Also expressed in (comments from author) : ASH amphid neuron; Also expression in a non-DiI stained, non-ASE/AWC head neuron pair sending dendrite to tip of nose (Hobert Lab 2005). | ||||
Strain: BC13449 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003173 |