WormBase Tree Display for Expr_pattern: Expr5601
expand all nodes | collapse all nodes | view schema
| Expr5601 | Homol | Homol_homol | C56G2:Expr |
|---|---|---|---|
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005439 | ||
| WBbt:0005735 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [C56G2.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTCCCCATATGATTGAACCTTTA] 3' and primer B 5' [CATTGGGATTGTCAATATTTTTCA] 3'. | |
| Pattern | Adult Expression: Nervous System; pharyngeal neurons; tail neurons; | ||
| Larval Expression: Nervous System; pharyngeal neurons; tail neurons; | |||
| Picture | WBPicture0000004392 | ||
| WBPicture0000004393 | |||
| Remark | Also expressed in (comments from author) : WormBase: The gene named C56G2.8 (WBGene00043222) has been superseded or retired | ||
| Strain: BC16288 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004203 | ||
| Historical_gene | WBGene00043222 | Note: This object originally referred to a gene (WBGene00043222) that is now considered dead. Please interpret with discretion. |
