WormBase Tree Display for Expr_pattern: Expr5601
expand all nodes | collapse all nodes | view schema
Expr5601 | Homol | Homol_homol | C56G2:Expr |
---|---|---|---|
Expression_data (2) | |||
Type | Reporter_gene | [C56G2.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTCCCCATATGATTGAACCTTTA] 3' and primer B 5' [CATTGGGATTGTCAATATTTTTCA] 3'. | |
Pattern | Adult Expression: Nervous System; pharyngeal neurons; tail neurons; | ||
Larval Expression: Nervous System; pharyngeal neurons; tail neurons; | |||
Picture | WBPicture0000004392 | ||
WBPicture0000004393 | |||
Remark | Also expressed in (comments from author) : WormBase: The gene named C56G2.8 (WBGene00043222) has been superseded or retired | ||
Strain: BC16288 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004203 | ||
Historical_gene | WBGene00043222 | Note: This object originally referred to a gene (WBGene00043222) that is now considered dead. Please interpret with discretion. |