Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5601

expand all nodes | collapse all nodes | view schema

Name Class

Expr5601HomolHomol_homolC56G2:Expr
Expression_data (2)
TypeReporter_gene[C56G2.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTCCCCATATGATTGAACCTTTA] 3' and primer B 5' [CATTGGGATTGTCAATATTTTTCA] 3'.
PatternAdult Expression: Nervous System; pharyngeal neurons; tail neurons;
Larval Expression: Nervous System; pharyngeal neurons; tail neurons;
PictureWBPicture0000004392
WBPicture0000004393
RemarkAlso expressed in (comments from author) : WormBase: The gene named C56G2.8 (WBGene00043222) has been superseded or retired
Strain: BC16288
ReferenceWBPaper00006525
TransgeneWBTransgene00004203
Historical_geneWBGene00043222Note: This object originally referred to a gene (WBGene00043222) that is now considered dead. Please interpret with discretion.