WormBase Tree Display for Expr_pattern: Expr5578
expand all nodes | collapse all nodes | view schema
Expr5578 | Expression_of | Gene | WBGene00004220 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004220 | ||
Homol | Homol_homol | C53C11:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (4) | |||
Type | Reporter_gene | [ptr-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCTGTTCAGAAAATCACTGTTCA] 3' and primer B 5' [CTCGGACATCCTACACTGCTC] 3'. | |
Pattern | Adult Expression: Nervous System; ventral nerve cord; head neurons; tail neurons; | ||
Larval Expression: Nervous System; ventral nerve cord; head neurons; tail neurons; | |||
Picture | WBPicture0000004356 | ||
WBPicture0000004357 | |||
WBPicture0000004358 | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC13075 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003080 |