WormBase Tree Display for Expr_pattern: Expr5384
expand all nodes | collapse all nodes | view schema
Expr5384 | Expression_of | Gene | WBGene00016260 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00016260 | ||
Homol | Homol_homol | C30F12:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005394 | ||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0006749 | |||
Type | Reporter_gene | [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; nerve ring; amphids; | ||
Larval Expression: intestine; Nervous System; nerve ring; amphids; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC11849 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002718 |