WormBase Tree Display for Expr_pattern: Expr5172

Expr5172 Expression_of: Gene: WBGene00002881
    Reflects_endogenous_expression_of: WBGene00002881
  Homol: Homol_homol: C05D11:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003679
      WBbt:0003681
      WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005813
  Type: Reporter_gene: [let-756::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACCCATTCCTTCTCGGTTT] 3' and primer B 5' [CAGGAACGGCGATATATTCA] 3'.
  Pattern: Adult Expression: pharynx; body wall muscle; Nervous System; neurons along body; unidentified cells in head;
    Larval Expression: pharynx; body wall muscle; Nervous System; neurons along body; unidentified cells in head;
  Remark: Also expressed in (comments from author) : unidentified cells in head, possibly neuralEmbryo incomplete. To be updated.
    Strain: BC12925
  Reference: WBPaper00006525
  Transgene: WBTransgene00004261