WormBase Tree Display for Expr_pattern: Expr5172
expand all nodes | collapse all nodes | view schema
| Expr5172 | Expression_of | Gene | WBGene00002881 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00002881 | ||
| Homol | Homol_homol | C05D11:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [let-756::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACCCATTCCTTCTCGGTTT] 3' and primer B 5' [CAGGAACGGCGATATATTCA] 3'. | |
| Pattern | Adult Expression: pharynx; body wall muscle; Nervous System; neurons along body; unidentified cells in head; | ||
| Larval Expression: pharynx; body wall muscle; Nervous System; neurons along body; unidentified cells in head; | |||
| Remark | Also expressed in (comments from author) : unidentified cells in head, possibly neuralEmbryo incomplete. To be updated. | ||
| Strain: BC12925 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004261 |
