WormBase Tree Display for Expr_pattern: Expr5116
expand all nodes | collapse all nodes | view schema
Expr5116 | Expression_of | Gene | WBGene00001127 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001127 | ||
Homol | Homol_homol | C02H7:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (6) | |||
Type | Reporter_gene | [C02H7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCCAAATCAATAGAGGGAGAGA] 3' and primer B 5' [CAACGCTGATCGCACTTTT] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; | ||
Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; | |||
Remark | Also expressed in (comments from author) : Other head and tail neurons besides amphids and phasmids | ||
Strain: BC13146 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003096 |