WormBase Tree Display for Expr_pattern: Expr5099
expand all nodes | collapse all nodes | view schema
| Expr5099 | Expression_of | Gene | WBGene00001333 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00001333 | ||
| Homol | Homol_homol | C01G8:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (10) | |||
| Type | Reporter_gene | [erm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATTTGTTTTGTTTCAGCGTTTC] 3' and primer B 5' [TAGCTCTTTTTGATGTCCGAGTC] 3'. | |
| Pattern | Adult Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; excretory cell; Nervous System; head neurons; neurons along body; | ||
| Larval Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; Reproductive System; developing uterus; developing spermatheca; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells; | |||
| Picture | WBPicture0000003614 | ||
| WBPicture0000003615 | |||
| WBPicture0000003616 | |||
| Remark | Also expressed in (comments from author) : quite a number of processes in head | ||
| Strain: BC10874 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002409 |
