WormBase Tree Display for Expr_pattern: Expr5091
expand all nodes | collapse all nodes | view schema
Expr5091 | Expression_of | Gene | WBGene00015301 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015301 | ||||
Homol | Homol_homol | C01F1:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005735 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [C01F1.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGAGGATGACCGAGTTTTT] 3' and primer B 5' [CGATGAGATCATGACGGATG] 3'. | |||
Pattern | Adult Expression: Nervous System; head neurons; tail neurons; unidentified cells in head; | ||||
Larval Expression: intestine; Nervous System; head neurons; tail neurons; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : unidentified cells in head, may be amphids | ||||
Strain: BC11701 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002665 |