Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5091

expand all nodes | collapse all nodes | view schema

Name Class

Expr5091Expression_ofGeneWBGene00015301
Reflects_endogenous_expression_ofWBGene00015301
HomolHomol_homolC01F1:Expr
Expression_data (2)
TypeReporter_gene[C01F1.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGAGGATGACCGAGTTTTT] 3' and primer B 5' [CGATGAGATCATGACGGATG] 3'.
PatternAdult Expression: Nervous System; head neurons; tail neurons; unidentified cells in head;
Larval Expression: intestine; Nervous System; head neurons; tail neurons; unidentified cells in head;
RemarkAlso expressed in (comments from author) : unidentified cells in head, may be amphids
Strain: BC11701
ReferenceWBPaper00006525
TransgeneWBTransgene00002665