WormBase Tree Display for Expr_pattern: Expr5091
expand all nodes | collapse all nodes | view schema
Expr5091 | Expression_of | Gene | WBGene00015301 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015301 | ||
Homol | Homol_homol | C01F1:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [C01F1.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGAGGATGACCGAGTTTTT] 3' and primer B 5' [CGATGAGATCATGACGGATG] 3'. | |
Pattern | Adult Expression: Nervous System; head neurons; tail neurons; unidentified cells in head; | ||
Larval Expression: intestine; Nervous System; head neurons; tail neurons; unidentified cells in head; | |||
Remark | Also expressed in (comments from author) : unidentified cells in head, may be amphids | ||
Strain: BC11701 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002665 |