Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5080

expand all nodes | collapse all nodes | view schema

Name Class

Expr5080Expression_ofGeneWBGene00001228
Reflects_endogenous_expression_ofWBGene00001228
HomolHomol_homolB0511:Expr
Expression_dataLife_stage (2)
Anatomy_term (17)
TypeReporter_gene[eif-3.E::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGACATTTTCACGTTTCACGA] 3' and primer B 5' [AAACTCCAATCAATTTTCTTAACG] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC10374
ReferenceWBPaper00006525
TransgeneWBTransgene00002216